University of Saskatchewan

CMG-Lab

Home » Resources & Protocols » Oat SSR Markers » AM Series
PDF

AM Series

SSR Marker (AM)
Tm (° C)
Length
Repeat Motif/Length      (cv. Ogle)
Left Primer 5' to 3'
Right Primer 5' to 3'
 
AM1 46 204 (AG)21.(CAGAG)6 GGATCCTCCACGCTGTTGA CTCATCCGTATGGGCTTTA
AM2 49 144 (AG)24 TGAATTCGTGGCATAGTCACAAGA AAGGAGGGCATAGGGAGGTATTT
AM3 51 280 (AG)35 CTGGTCATCCTCGCCGTTCA CATTTAGCCAGGTTGCCAGGTC
AM4 48 166 (AG)34 GGTAAGGTTTCGAAGAGCAAAG GGGCTATATCCATCCCTCAC
AM5 46 172 (AG)27 TTGTCAGCGAAATAAGCAGAGA GAATTCGTGACCAGCAACAG
AM6 52 209 (AG)20 AATGAAGAAACGGGTGAGGAAGTG CCAGCCCAGTAGTTAGCCCATCT
AM7 48 156 (AG)21 GTGAGCGCCGAATACATA TTGGCTAGCTGCTTGAAACT
AM8 47 254 (AG)15 CAAGGCATGGAAAGAAGTAAGAT TCGAAGCAACAAATGGTCACAC
AM9 48 217 (AG)19 CAAAGCATTGGGCCCTTGT GGCTTTGGGACCTCCTTTCC
AM10 46 186 (AG)20 AAAATCGGGGAAGGAAACC GAAGGCAAAATACATGGAGTCAC
AM11 49 225 (AG)12.(AAAG)3 TCGTGGCAGAGAATCAAAGACAC TGGGTGGAGGCAAAAACAAAAC
AM12 44 310 (AG)20 TGCTGAAGTGAACAATCGC CCTTCTCCAACAACTCTAC
AM13 54 201 (AG)15 CGGCGTGATTTGGGGAAGAAG CTAGTAACGGCCGCCAGTGTGCTG
AM14 48 133 (AC)21 GTGGTGGGCACGGTATCA TGGGTGGCGAAGCGAATC
AM15 47 229 (AC)14 GTGACCGTAAACGATAACAAC AAGCAAGACGCGAGAGTAGG
AM16 44 114 (AG)4..(AC)16 CGGGTTGGCATCGACTAT TGACCAGGCTCTAACACA
AM17 44 250 (AC)13 CGAGATTTCGGTGTAGAC CCGGGAATTAACGGAGTC
AM18 47 270 (AC)14 CAATGTCGTCGGTGTGAGTTT TACGAGTGTGGCACGAGC
AM19 48 251 (AC)3..(AC)6..(AC)5..(AC)7 ATAGAACGGCATGATAACGAAATA GCGCGACAACAGGACCTTC
AM20 50 258 (TG)10.(CG)5 TGTCGATTTCTTTAGGGCAGCACT TCGCGAGAAAGATGGAAAGGAGA
AM21 46 210 (AT)5..(AC)5..(AC)5 ACGTTGGTCTCGGGTTGG AAATCCTTGACTTCGCTCTGA
AM22 46 138 AC)22 ATTGTATTTGTAGCCCCCAGTTC AAGAGCGACCCAGTTGTATG
AM23 45 247 (AC)19 TCTTTAAGGATTTGGGTGGAG AATCTTCGAGGGTGAGTTTCT
AM24 45 170 (AAG)5..(TCA)5 GTTATTGATTTCCTGATGTAGAGA AGAGCCAAGAAAGCAACTG
AM25 47 229 (AC)8..(AC)4(CT)4 AGCCTGGACATGTAATCTGGT AGCCCTGGTCTTCTTCAACA
AM26 41 224 (AAG)14 ATAAAGGGGGCATTGGATT AACATATTGGGCATTCACAT
AM27 45 161 (AAG)10 CAAAGGCCAAATGGTGAG CCGCAAAGTCATATGGAGCAT
AM28 46 135 (GAA)8 GACCTCTTGAGTAAGCAACG TGGTCTTCCTATCCACAATG
AM29 43 143 (GAA)9 TCCCGCAAAATCATCACGA AAGGGAGCATTGGTTTTGTT
AM30 43 203 (GAA)14 TGAAGATAGCCATGAGGAAC GTGCAAATTGAGTTTCACG
AM31 47 186 (GAA)23 GCAAAGGCCATATGGTGAGAA CATAGGTTTGCCATTCGTGGT
AM32 47 295 (GAA)19 AGTGAAGGCGATGGCGAA GGATAATGCACCCGAGTTGC
AM33 43 246 (GAA)15 GCAAAGGTTAAATGGTGAGA GCCAACATATTGTGCATACA
AM34 44 181 (GAA)10 GAGTAAGCAAAGGTCAAATG GTTAGCACTTCCCACAAAATCA
AM35 47 216 (GAA)14 CGTGACCTTTATATCACCACT GTGGCTCGTGATATTGGCAC
AM36 43 142 (GAA)9 CTTCCCGCAAAGTTATCAT AGGGGCATTGGCTTTGTC
AM37 47 213 (GAA)9 CTTCCACAAGGCAACGAGTC GGTTAGCACTTCCCGCAAA
AM38 45 178 (GAA)9 TGATGACCTCTTGAGTAAGCA TGCCTTTCGTGGACTTACTA
AM39 43 238 (GAA)8 TTGGGCATGCCCTTGTT GCCTTGGAGAGTAAATTCTC
AM40 49 249 (GAA)7 CTCTGGGGGTGGTAGTTCCT GAAAGACAGGCCTCCACAAAT
AM41 42 205 (GAA)10 CCAAAGGAAACAAGTCAATAG TTCCCGCAAAGTCATCAT
AM42 45 193 (GAA)16 GCTTCCCGCAAATCATCAT GAGTAAGCAAAGGCCAAAAAGT
AM43 46 162 (GAA)17 AGCCCCTACAAAGCCATCA CAAGCAAAGGACGAACAATAG
AM44 49 174 (GAA)11 CGTTGGCCCCTTTTTTCAGTG AGGGGCATTGGCTTTGTCC
AM45 47 191 (AC)9 AGGGAAAAACAAAACGTGAGAGTA ATGCAACAGATAGACAAGGGATTA
AM46 46 105 (AC)9 TTGGCAAGGCGAGGTCT CCAAAAGGCTACAACATCACAC
AM47 50 274 (AC)14 GCACCGGTTAAAAAGGAGTCAG TTTCTTCTTACCCACCCACCAC
AM48 46 191 (AC)25 ATTCGTGGCTCCTGTGC GTGTACGTTAACTCCCCTCTAT
AM49 45 220 (T)5..(TC)3(AC)3 TAGAAAAAGGAAAGTTAGGGTTAG TGAAATTGACTGTTATGTGGTTAC
AM50 47 273 (AT)6..(AC)5 CTTGAGCGCTAGATGGTTCC CTCTGTTACTCAAGTGTTTCAATA
AM51 49 229 (AC)3..(AT)5 AATCGGACCTATGCAAGTTTCAG AGTCGGACGCTCTATCATTCTCA
AM52 46 229 (AC)4..(AC)4 ATAGTGCCATGACCAATCTT GTCTAGCCCACTCAAACACCA
AM53 50 261 (AC)10 TCGCCATTAATAAGAGGGAAGG GCTGCTGTTGGGTGGTTAGTG
AM54 47 186 (AC)9 AAACCCGTGCAAGAAACCAA TGCGGGAGGAGGGAAGAC
AM55 45 163 (T)7..(AC)4 TATTTGCGGGCTGAAGTTTGTA GGTCATTTGATATCTCCATTCTA
AM56 45 156 (AG)8 CGCGACGGCTTTGTGTT CCGCGCCTCTTTGGTATT
AM57 46 182 (CCT)3(AAG)3 TCACGCGATGGGCAGAA CGCGCTTCCAAGGTATTATC
AM58 45 215 (CT)5..(AC)3 GTTTAGATGGGGGTGGCTTAG TTTCTTGTTCTTTGGATTTTATTT
AM59 44 275 (G)12..(GA)5 TCTGGGCTACGAAAATGTT CCGGCGGAAATGGAGTG
AM60 45 242 (NNT)8..(AT)5 GAAGCGCGTCAGTTGATG AGCCCACGTTCACTCCAT
AM61 51 206 (TTTC)4..(CCT)6 TCGGAGCCGGTATGGAAGC GGTGGCAAGGGGTGTATGAG

NOTE: Insert reference for AM series.