University of Saskatchewan

CMG-Lab

Home » Resources & Protocols » Oat SSR Markers » cAM Series
PDF

cAM Series

SSR Marker (cAM)
Tm (° C)
Length
Quality
Repeat Motif/Length     (CDC Dancer)
Left Primer 5' to 3'
Right Primer 5' to 3'
 
cAM01 60 275 1 (AC)17 CGTCTTCTTGATCTTTCCTG TATGATAACCGTTCCCTGAC
cAM02 60 274 2 (GA)16 CTTCGCTTCTCCGATTTG ATAGTACACATCAGCCGTCC
cAM03 57 140 1 (CTG)9 ATCGCGCTGTACCTATAATC GCTCCAAACAACACGTAAAT
cAM04 57 156 2 (GTG)9 GGTAGAGACCGTAATGGTGA TCTAGCAAAGTGTCCAGGTT
cAM05 57 310 4 (AGG)9 CACGCAGCACCACTACTAC GGAGGCTGTTGTTGTTATTG
cAM06 57 355 1 (CAC)8 GTGACTCCTCAACCACACA CTTGATGTAGCGTCCGTAGT
cAM07 57 160 1 (AAG)8 CAGGAAATAATATAACGCCG CTTCTCAGATTTGGAACTCG
cAM08 57 377 1 (GA)11 AGAGAGGCAGAACAGAACAA CTGTCCTTGACATCTCCTTC
cAM09 57 193 1 (GA)11 TTCTTCTTCTTCTTGTTGGC GCAAGTACTGTGTTGCAGAA
cAM10 57 183 1 (CCGT)6 CGTCCTGTGTCTTTACTTCC AGCACCAGATGGTCTACAAC
cAM11 57 375 1 (CCG)8 CACTCCTCCAAACCCTTT GATCTCGTCGATACGGAATA
cAM12 57 220 4 (GA)10 AGCAATTCAAAGCATCTCC GTATCTGCCCTTCTTGAGG
cAM13 57 377 1 (CGAAT)4CGAA ACAACCGCCGAAGCGAAAC AAGATCAAGAACGCAGTCTC
cAM14 57 277 4 (CTC)7 CACGCTATTGATTGCTGC GGTATGATGATATTGACGGC
cAM15 57 347 5 (GCG)7 CTCTGTTTGTTGAGTGGACA GGTAAATGTGACTGGGAAGA
cAM16 57 147 4 (GCC)7 GAAATCTCCTCCTCCTCTTC TCTCTTGTTCCACGTAGTCA
cAM17 57 379 1 (GAA)5GA(GAA)3 AACCCTAGCCAGGCTCTA CTCAGAGTGCCCTGAGTTAC
cAM18 60 393 4 (ACA)7 AGTATGACCCTAGCGAACAA AACTCCGATGGTCCATTTAT
cAM19 57 219 2 (CGG)7 CAGCTAAATGTACTGAGCCC AGTTGGATCAGCAGAGAAGA
cAM20 57 396 1 (CTC)7 AACACGGAAGCAAGGGTA TACATCTGGAGATGGCTCTT
cAM21 57 353 1 (GCA)7 GTGAAGTCAATGCAGATCG AGGATCTCCTCCCTGTACTC
cAM22 60 214 4 (AAG)5GAG(AAG)2 ACGATGATCACAAGAAGGAC GGAGCTCAGTCGCTGTCG
cAM23 57 380 1 (CAC)6CA TTTCGTCGTATCTAAGGCAT AGCAGAAGGTGATGGAGTAA
cAM24 57 274 1 (GGC)7 TATTCTGCTTTGCCCTCATA TCTTGTGGATATTTGGAAGG
cAM25 60 175 4 (CTT)6CT AGACAAGAATTTCTCCCAT GTGGAGATATGGTCGTTGTT
cAM26 57 276 1 (GGA)6GG CTGTCTCAAATGGATCGTG TCCTAAGCTTTCTGTTCTCG
cAM27 57 330 1 (AGG)7 TGTAGTCCAGGAAGCACTCT TCTGTTTGCTCAACTGCTAA
cAM28 57 330 3 (AGCT)5 CCACAATTACGATGAGGAGT TCAAGCACTATGCAGTTGTC
cAM29 57 284 3 (TCGG)5 GGTAGTCGTCGTCCTCCT CTAACTCTTGGTCCTTGACG
cAM30 57 284 3 (CCTC)5 CTCCGGAAGTGAACGAAG GCTAGCAGAAATGAGAGGAA
cAM31 55 124 4 (CAG)5CAA(CAG)3 AGATGCAGCAAACATCTTCT CTGTTGTTCTGTTGCATTTG
cAM32 57 239 1 (TGG)5AGGCGG(TGG)4 TAAGAGTGGAACCTGCTCAT ACTGCCTTCACGATACACTT
cAM33 55 385 3 (GT)5CT(GT)5 TGGCGTGAGAGTATACATGA AAGACCAGAGCATAGCAGAG
cAM34 60 175 3 (GCC)7 GAAATCTCCTCCTCCTCTTC TCTCTTGTTCCACGTAGTCA
cAM35 60 127 3 (TGC)6TG GTCAACCGCTAAGTTGAGTT AAACAGCAGATGATTTGGAG
cAM36 60 330 3 (AGCT)4 CCACAATTACGATGAGGAGT TCAAGCACTATGCAGTTGTC
cAM37 60 329 1 (GT)5CT(GT)6 TGGCGTGAGAGTATACATGA AAGACCAGAGCATAGCAGAG
cAM38 60 301 3 (GAT)3GAA(GAT)3 GATTACCTTCTGTCTCGCAG TCTCCTCTTCAGTCTCCTCA
cAM39 60 228 3 (GAT)3GAA(GAT)3 CAGCTGTACCTGTAGCATCA TAACCATGTCAGTCTCGTCA
cAM40 57
166 1 (GT)9G GATCTCAAGTGAAGTCGGAG TTGCAAAGCATAATACAACG
cAM41  57 197 2 (GT)9G GAGTCTATGTCAGCAAAGGG AGAACGTGCGATAAATCAAC
cAM42  60 248 5 (CTC)6C CAGACTGCCCAACCCGAC AACTTGTGATCCCTGTCTTG
cAM43  57 101 2 (TTC)6T GGACTCCTCTCCTCTCAGTT GGTTACAAGTGCTCCTTGAG
cAM44  57 254 1 (GT)8G ATGATCAAAGGAACATCAGG CGCACTAAACATTATCCCTC
cAM45  57 171 4 (GA)9 TCTTCAGAGTTCACAAGCAA TTGTCGACCTTGATCTTCTT
cAM46  60 207 2 (GCC)6G TCTTCTTCTTCCTCCTCCTC GTTGGTGATCTTCTTCAGGA
cAM47  57 268 3 (CT)8C TAGTTGGTTCTCGAACACG CTGAGGAAGGAGAGGTTGTT
cAM48  57 252 1 (GT)8G ATGATCAAAGGAACATCAGG CGCACTAAACATTATCCCTC
cAM49  63 385 1 (GAG)6 AACAATGTCGGTATCAGAGC CCAAGAACAAATGAACACCT
cAM50  63 357 2 (GCG)6 GTCACAAGCAGAACCAAATC AGATACTGACGCCTTGGAG
cAM51  63 348 1 (GAGC)4GAG TACACATCCAAACACAGAGC TCGGCTGTCCAGTACTTATT
cAM52  63 389 3 (GCTA)4GCT GATTGGCTTGCTTCGTCC ACCGTAGAGATACGCCATAG
cAM53  57 215 1 (GCA)6 CTTCCATTCTGTCACCAGAT TCCATTCAAATTGAGCTTCT
cAM54  63 395 1 (GCG)6 TTTGCCCTCGCCTCCAAA ACAAACTTCACATCAGGACC
cAM55  63 335 5 (GCA)6 ACAACAAATGTTTCTCCAGC GTTGTTGCAGTTGTAGCTGA
cAM56  63 332 2 (CGC)6 AATCAGATCAGCCTCAGAGA TGTCGCTGTTCTGGTACAC
cAM57  57 281 4 (GGC)6 AATCTCAGACCCTCCAGC CTAGAACAGTGTAGCCTTCGC
cAM58  57 134 1 (CTC)6 GCAGTCACGAGACATAAACA TGCAGACAGAGTCTCCTGAT
cAM59  57 217 1 (CGC)6 ATTGAAGAGAAGAGATTGCG TTTGGTTGCTTCTAGGGATA
cAM60  60 333 2 (GAG)6 CTTTGGAGATGGCAACAA CCTCGACTTTGATGGAGTAG
cAM61  57 375 2 (AAG)6 TGAATCCAGTATGTGCTGAG CACTCTCCTCTTCATCTTCG
cAM62  60 291 2 (GA)8 CTGTTTCCTCCTTTGCTCT CCATCATCTCCATTTCTTGT
cAM63  57 171 1 (TGGA)4TG GCGGTGGTTCTAGTTGATAG ATCACAAGTACTAACATCAGTTT
cAM64  57 268 2 (TCGC)4TC GGCATCGATTAGGCAGTAG GAAGAATCCCATCTTGTTGA
cAM65  63 356 4 (GAG)5GA ACTCCGACCTATCTCCCAT CTCATCGTCCTCGTCATC
cAM66  57 125 2 (CT)4C(CT)6 GACCAAATTTAGCCGTTACA ATTTGTTCCTTGATGACCTG
cAM67  57 304 2 (GAG)3GCG(GAG)3G CTTCTTCCAGCTCAAGACAC AGTGATGTCGAGCTTGTTCT
cAM68  63 208 3 (CGC)4CACCGCCAC(CGC)3 GCCCTTATCTTCTCTCTGCT CTCTGAAGCCTCTTGTCATC
cAM69  63 346 3 (GCC)4GCT(GCC)2G CGATTAACACTCTGCCTCC ATACTTGGCTTTCACAGCAT
cAM70  63 242 2 (TGA)4CGA(TGA)2 GAAACTGCTCCTACTGATGC CATCTTCCTCATCGTCATC
cAM71 60 550 2 (CTA)4GTA(CTA)2 GATAGAAACCCATAGTCCTCTT TCAGGGAAACATTAGTGACC

Quality Definitions

  1. Strong amplification product, single (maybe 2) bands, easy to score
  2. Good amplification product, single (maybe 2) bands
  3. Strong amplification product, 2 to 4 loci amplified
  4. Good amplification product, 2 to 4 loci amplified, may be difficult to score
  5. Weak amplification products and/or multiple loci amplified. Difficult to score.