University of Saskatchewan

CMG-Lab

Home » Resources & Protocols » TaqMan Assays » Barley Assays
PDF

TaqMan For Barley

 

Assay Name

Trait / Chromosome

Assay Oligonucleotide Sequences

Reference

Amo1SNP2

High amylose QTL

 

Chromosome 1HS

Amo1F - TCTATCGCCAGACTCATCATCGA

Amo1R - GCAGACTACACAGCTAAGACACA

Amo1V - VIC-TTGGAACTCGGTGTCAAA-NFQ

Amo1M - FAM-TTGGAACTCAGTGTCAAA-NFQ

(NFQ = non-fluorescent quencher, ABI minor groove binder)

SNP locus = "G" to "A" substitution

Locus position estimated per Box et al. (2007).   DNA sequences per unigene listings at HarvEST:Barley  (http://harvest.ucr.edu).

Un8SNP4

True Loose Smut Resistance

 

Chromosome 1HL

 

Linked (approx 2cM) SNP

Un8F - CTACATCTGCTCCTGCGACTT

Un8R - TCAAAATCGAGCTTCCCATCACAAT

Un8V - VIC-CACAGTATATCGCACGAGAA-NFQ

Un8M - FAM-TCACAGTATATCACACGAGAA-NFQ

(NFQ = non-fluorescent quencher, ABI minor groove binder)

SNP locus = "G" to "A" substitution

Locus position estimated per Eckstein et al. (2002).   DNA sequences per unigene listings at HarvEST:Barley  (http://harvest.ucr.edu).

Pt6SNP2

Net-blotch Resistance QTL

 

Chromosome 6HS

Pt6F - TCAGGTGCCAGATGAACTTCAAG

Pt6R - CTCCATGGCCTTGATCAAAGTTG

Pt6V - VIC-CTTTCACTGACTGACATCA-NFQ       

Pt6M - FAM-TTCACTGACCGACATCA-NFQ

(NFQ = non-fluorescent quencher, ABI minor groove binder)

SNP locus = "T" to "C" substitution

Locus position estimated per Grewal et al. (2008).  DNA sequences per unigene listings at HarvEST:Barley  (http://harvest.ucr.edu).

Rpg1SNP1

Leaf Rust Resistance

 

Chromosome 7HS

 

Functional SNP

Rpg1F - TGCCACCAGAATACATCAGTAAACG      

Rpg1R - GCAAGATTATGACACCCAGACTGAA     

Rpg1V - VIC-ATCACATCAAGGTTTAATGT-NFQ

Rpg1M - FAM-CTAATCACATCAAGTAATGT-NFQ

(NFQ = non-fluorescent quencher, ABI minor groove binder)

SNP locus = a "GTT" insertion/deletion

Functional SNP information per Brueggeman et al. (2002), Eckstein et al. (2003).

LOX1SNP1

Lipoxygenase 1

 

Chromosome 4HS

 

Functional SNP

Details available by request

Functional SNP information per Hirota et al. (2006).