University of Saskatchewan

CMG-Lab

Home » Resources & Protocols » TaqMan Assays » Oat Assays
PDF

TaqMan For Oat

Assay Name

Trait / Chromosome

Assay Oligonucleotide Sequences

Reference

Pc91SNP2

Crown Rust Resistance

 

Linkage Group 1_3_38 on Kanota/Ogle (DArT) mapping population

 

Linked (< 1cM) SNP

Pc91F - CACAAGCATATATGTTGCAATGAT

Pc91R - GGCGCAAACTCAATCTTGTGTT

Pc91V - VIC-CATTACCCACCGGCATGA-NFQ

Pc91M - FAM-CCACATTACCCAGCATGA-NFQ

(NFQ = non-fluorescent quencher, ABI minor groove binder)

SNP locus = a "CCG" insertion/deletion

Locus position per McCartney et al. (2009).  DNA sequences obtained from oat specific (oPt) DArT probes per Tinker et al. (2008).

PcKMSNP1

Crown Rust Resistance

 

Linkage Group 2 on

Kanota/Ogle (DArT) mapping population

 

Linked (< 1cM) SNP

PcKMF - TGGGCCTACCTTCTTACTAAGATTG

PcKMR - TTCGAGTCATGTCATCTACAAATGCA

PcKMV - VIC-CTAGATATGGAGGAATTG-NFQ

PcKMM - FAM-CTAGATATGGAGGGATTG-NFQ

(NFQ = non-fluorescent quencher, ABI minor groove binder)

SNP locus = "G" to "A" substitution

 

ADLSNP1

Acid Detergent Lignin QTL

 

Linkage Group 24_26_34 on Kanota/ Ogle mapping population

 

Linked (approx 1cM) SNP

ADLF - GTTTTCTATGAGGCAGACGCTAATGA     

ADLR - GCCTGCCGCTAGACGTTT            

ADLV - VIC-TGGGATATTCAGTGTCAAAAG-NFQ ADLM - FAM-ATGGGATATTCAGTGTCAAG-NFQ

(NFQ = non-fluorescent quencher, ABI minor groove binder)

SNP locus = a "AA" insertion/deletion

Locus position per Rossnagel et al. (2004).  DNA sequences obtained from oat specific (oPt) DArT probes per Tinker et al. (2008).